Mouse OY-TES-1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGF558-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
951bp
Gene Synonym
sp32, OY-TES-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse proacrosin binding protein Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OY-TES-1 is a member of CT antigens, which was originally identified as the human homologue of proacrosin binding protein sperm protein 32 precursor. OY-TES-1 mRNA was expressed not only in testis but also in different malignant tissues, including bladder, breast, lung, liver, colon and epithelial ovarian cancers. About 3.5% to 10.5% of cancer patients have developed humoral immune response to OY-TES-1. A HLA-A24-binding peptide was identified and recognized by CD8+ T-cell, and thus caused cytotoxicity to tumor cells expressing OY-TES-1. More recently, researches indicated that OY-TES-1 normalized mitotic spindle function to promote cancer cell proliferation, and expressed in mesenchymal stem cells. In the mouse, two functional forms of OY-TES-1 were produced by pre-mRNA alternative splicing, and may play different role in spermiogenesis and fertilization.
References
  • Luo B, Yun X, Fan R, et al. Cancer testis antigen OY-TES-1 expression and serum immunogenicity in colorectal cancer: its relationship to clinicopathological parameters. International Journal of Clinical and Experimental Pathology. 2013;6(12):2835-2845.
  • Fan R, Huang W, Luo B, et al. Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays[J]. European journal of gynaecological oncology, 2014, 36(3): 298-303.
  • TOP