Mouse OY-TES-1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001127340.1

RefSeq ORF Size

951bp

Gene Synonym

sp32, OY-TES-1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse proacrosin binding protein Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

OY-TES-1 is a member of CT antigens, which was originally identified as the human homologue of proacrosin binding protein sperm protein 32 precursor. OY-TES-1 mRNA was expressed not only in testis but also in different malignant tissues, including bladder, breast, lung, liver, colon and epithelial ovarian cancers. About 3.5% to 10.5% of cancer patients have developed humoral immune response to OY-TES-1. A HLA-A24-binding peptide was identified and recognized by CD8+ T-cell, and thus caused cytotoxicity to tumor cells expressing OY-TES-1. More recently, researches indicated that OY-TES-1 normalized mitotic spindle function to promote cancer cell proliferation, and expressed in mesenchymal stem cells. In the mouse, two functional forms of OY-TES-1 were produced by pre-mRNA alternative splicing, and may play different role in spermiogenesis and fertilization.

References

Luo B, Yun X, Fan R, et al. Cancer testis antigen OY-TES-1 expression and serum immunogenicity in colorectal cancer: its relationship to clinicopathological parameters. International Journal of Clinical and Experimental Pathology. 2013;6(12):2835-2845.

Fan R, Huang W, Luo B, et al. Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays[J]. European journal of gynaecological oncology, 2014, 36(3): 298-303.

Catalog Number:MGF558-CO