Mouse OY-TES-1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF558-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
951bp
Gene Synonym
sp32, OY-TES-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse proacrosin binding protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OY-TES-1 is a member of CT antigens, which was originally identified as the human homologue of proacrosin binding protein sperm protein 32 precursor. OY-TES-1 mRNA was expressed not only in testis but also in different malignant tissues, including bladder, breast, lung, liver, colon and epithelial ovarian cancers. About 3.5% to 10.5% of cancer patients have developed humoral immune response to OY-TES-1. A HLA-A24-binding peptide was identified and recognized by CD8+ T-cell, and thus caused cytotoxicity to tumor cells expressing OY-TES-1. More recently, researches indicated that OY-TES-1 normalized mitotic spindle function to promote cancer cell proliferation, and expressed in mesenchymal stem cells. In the mouse, two functional forms of OY-TES-1 were produced by pre-mRNA alternative splicing, and may play different role in spermiogenesis and fertilization.
References
  • Luo B, Yun X, Fan R, et al. Cancer testis antigen OY-TES-1 expression and serum immunogenicity in colorectal cancer: its relationship to clinicopathological parameters. International Journal of Clinical and Experimental Pathology. 2013;6(12):2835-2845.
  • Fan R, Huang W, Luo B, et al. Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays[J]. European journal of gynaecological oncology, 2014, 36(3): 298-303.
  • TOP