Mouse OY-TES-1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001127340.1

RefSeq ORF Size

951bp

Gene Synonym

sp32, OY-TES-1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse proacrosin binding protein Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

OY-TES-1 is a member of CT antigens, which was originally identified as the human homologue of proacrosin binding protein sperm protein 32 precursor. OY-TES-1 mRNA was expressed not only in testis but also in different malignant tissues, including bladder, breast, lung, liver, colon and epithelial ovarian cancers. About 3.5% to 10.5% of cancer patients have developed humoral immune response to OY-TES-1. A HLA-A24-binding peptide was identified and recognized by CD8+ T-cell, and thus caused cytotoxicity to tumor cells expressing OY-TES-1. More recently, researches indicated that OY-TES-1 normalized mitotic spindle function to promote cancer cell proliferation, and expressed in mesenchymal stem cells. In the mouse, two functional forms of OY-TES-1 were produced by pre-mRNA alternative splicing, and may play different role in spermiogenesis and fertilization.

References

Luo B, Yun X, Fan R, et al. Cancer testis antigen OY-TES-1 expression and serum immunogenicity in colorectal cancer: its relationship to clinicopathological parameters. International Journal of Clinical and Experimental Pathology. 2013;6(12):2835-2845.

Fan R, Huang W, Luo B, et al. Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays[J]. European journal of gynaecological oncology, 2014, 36(3): 298-303.

Catalog Number:MGF558-NM