Mouse OY-TES-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGF558-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
951bp
Gene Synonym
sp32, OY-TES-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse proacrosin binding protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OY-TES-1 is a member of CT antigens, which was originally identified as the human homologue of proacrosin binding protein sperm protein 32 precursor. OY-TES-1 mRNA was expressed not only in testis but also in different malignant tissues, including bladder, breast, lung, liver, colon and epithelial ovarian cancers. About 3.5% to 10.5% of cancer patients have developed humoral immune response to OY-TES-1. A HLA-A24-binding peptide was identified and recognized by CD8+ T-cell, and thus caused cytotoxicity to tumor cells expressing OY-TES-1. More recently, researches indicated that OY-TES-1 normalized mitotic spindle function to promote cancer cell proliferation, and expressed in mesenchymal stem cells. In the mouse, two functional forms of OY-TES-1 were produced by pre-mRNA alternative splicing, and may play different role in spermiogenesis and fertilization.
References
  • Luo B, Yun X, Fan R, et al. Cancer testis antigen OY-TES-1 expression and serum immunogenicity in colorectal cancer: its relationship to clinicopathological parameters. International Journal of Clinical and Experimental Pathology. 2013;6(12):2835-2845.
  • Fan R, Huang W, Luo B, et al. Cancer testis antigen OY-TES-1: analysis of protein expression in ovarian cancer with tissue microarrays[J]. European journal of gynaecological oncology, 2014, 36(3): 298-303.
  • TOP