Mouse CFHR1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGB523-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
CFHRB; Cfhl1; AI194696
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement factor H-related 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CFHR1 is a secreted protein belonging to the complement factor H protein family.The human complement factor H protein family consists of the complement and immune regulators factor H, the factor H-like protein 1(FHL-1) and five factor H-related proteins (CFHR-1 to -5). Members of the H-related protein family are exclusively composed of individually folded protein domains, termed short consensus repeats (SCRs) or complement control modules. CFHR1 binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. CFHR1 might be involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism.
References
  • Martnez-Barrica, et al. (2012) Relevance of complement factor H-related 1 (CFHR1) genotypes in age-related macular degeneration. Invest Ophthalmol Vis Sci. 53(3):1087-94.
  • Leban N, et al. (2012) Factor H and CFHR1 polymorphisms associated with atypical Haemolytic Uraemic Syndrome (aHUS) are differently expressed in Tunisian and in Caucasian populations. Int J Immunogenet. 39(2):110-3.
  • Kubista KE, et al. (2011) Copy number variation in the complement factor H-related genes and age-related macular degeneration. Int J Immunogenet. Mol Vis. 17:2080-92.
  • TOP