Mouse CFHR1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB523-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
CFHRB; Cfhl1; AI194696
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement factor H-related 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CFHR1 is a secreted protein belonging to the complement factor H protein family.The human complement factor H protein family consists of the complement and immune regulators factor H, the factor H-like protein 1(FHL-1) and five factor H-related proteins (CFHR-1 to -5). Members of the H-related protein family are exclusively composed of individually folded protein domains, termed short consensus repeats (SCRs) or complement control modules. CFHR1 binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. CFHR1 might be involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism.
References
  • Martnez-Barrica, et al. (2012) Relevance of complement factor H-related 1 (CFHR1) genotypes in age-related macular degeneration. Invest Ophthalmol Vis Sci. 53(3):1087-94.
  • Leban N, et al. (2012) Factor H and CFHR1 polymorphisms associated with atypical Haemolytic Uraemic Syndrome (aHUS) are differently expressed in Tunisian and in Caucasian populations. Int J Immunogenet. 39(2):110-3.
  • Kubista KE, et al. (2011) Copy number variation in the complement factor H-related genes and age-related macular degeneration. Int J Immunogenet. Mol Vis. 17:2080-92.
  • TOP