Mouse CFHR1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_015780.2

RefSeq ORF Size

1032bp

Gene Synonym

CFHRB; Cfhl1; AI194696

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse complement factor H-related 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CFHR1 is a secreted protein belonging to the complement factor H protein family.The human complement factor H protein family consists of the complement and immune regulators factor H, the factor H-like protein 1(FHL-1) and five factor H-related proteins (CFHR-1 to -5). Members of the H-related protein family are exclusively composed of individually folded protein domains, termed short consensus repeats (SCRs) or complement control modules. CFHR1 binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. CFHR1 might be involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism.

References

Martnez-Barrica, et al. (2012) Relevance of complement factor H-related 1 (CFHR1) genotypes in age-related macular degeneration. Invest Ophthalmol Vis Sci. 53(3):1087-94.

Leban N, et al. (2012) Factor H and CFHR1 polymorphisms associated with atypical Haemolytic Uraemic Syndrome (aHUS) are differently expressed in Tunisian and in Caucasian populations. Int J Immunogenet. 39(2):110-3.

Kubista KE, et al. (2011) Copy number variation in the complement factor H-related genes and age-related macular degeneration. Int J Immunogenet. Mol Vis. 17:2080-92.

Catalog Number:MGB523-CY