Mouse CFHR1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB523-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1032bp
Gene Synonym
CFHRB; Cfhl1; AI194696
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement factor H-related 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CFHR1 is a secreted protein belonging to the complement factor H protein family.The human complement factor H protein family consists of the complement and immune regulators factor H, the factor H-like protein 1(FHL-1) and five factor H-related proteins (CFHR-1 to -5). Members of the H-related protein family are exclusively composed of individually folded protein domains, termed short consensus repeats (SCRs) or complement control modules. CFHR1 binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. CFHR1 might be involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism.
References
  • Martnez-Barrica, et al. (2012) Relevance of complement factor H-related 1 (CFHR1) genotypes in age-related macular degeneration. Invest Ophthalmol Vis Sci. 53(3):1087-94.
  • Leban N, et al. (2012) Factor H and CFHR1 polymorphisms associated with atypical Haemolytic Uraemic Syndrome (aHUS) are differently expressed in Tunisian and in Caucasian populations. Int J Immunogenet. 39(2):110-3.
  • Kubista KE, et al. (2011) Copy number variation in the complement factor H-related genes and age-related macular degeneration. Int J Immunogenet. Mol Vis. 17:2080-92.
  • TOP