Mouse CDK2AP2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_026373.4

RefSeq ORF Size

384bp

Gene Synonym

Doc-1r; D19Ertd144e; 5830466O21Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CDK2-associated protein 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CDK2AP2 belongs to the CDK2AP family. Members of this family of proteins are cell-growth suppressors, associating with and influencing the biological activities of important cell cycle regulators in the S phase including monomeric non-phosphorylated cyclin-dependent kinase 2 (CDK2) and DNA polymerase alpha/primase. CDK2AP2 contains 5 distinct gt-ag introns. Transcription produces 7 different mRNAs, 6 alternatively spliced variants and 1 unspliced form. There are 2 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ splicing versus retention of 3 introns. CDK2AP2 plays a role in regulating self-renewal of mouse embryonic stem cells (mESC) under permissive conditions, and cell survival during differentiation of the mESC into terminally differentiated cell types.

References

Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.

2 Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.

3 Buajeeb W, et al. (2004) Interaction of the CDK2-associated protein-1, p12(DOC-1/CDK2AP1), with its homolog, p14(DOC-1R). Biochem Biophys Res Commun. 315(4):998-1003

Catalog Number:MGB454-NY