Mouse CDK2AP2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB454-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
384bp
Gene Synonym
Doc-1r; D19Ertd144e; 5830466O21Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CDK2-associated protein 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDK2AP2 belongs to the CDK2AP family. Members of this family of proteins are cell-growth suppressors, associating with and influencing the biological activities of important cell cycle regulators in the S phase including monomeric non-phosphorylated cyclin-dependent kinase 2 (CDK2) and DNA polymerase alpha/primase. CDK2AP2 contains 5 distinct gt-ag introns. Transcription produces 7 different mRNAs, 6 alternatively spliced variants and 1 unspliced form. There are 2 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ splicing versus retention of 3 introns. CDK2AP2 plays a role in regulating self-renewal of mouse embryonic stem cells (mESC) under permissive conditions, and cell survival during differentiation of the mESC into terminally differentiated cell types.
References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • 2 Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • 3 Buajeeb W, et al. (2004) Interaction of the CDK2-associated protein-1, p12(DOC-1/CDK2AP1), with its homolog, p14(DOC-1R). Biochem Biophys Res Commun. 315(4):998-1003
  • TOP