Mouse CDK2AP2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGB454-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
384bp
Gene Synonym
Doc-1r; D19Ertd144e; 5830466O21Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CDK2-associated protein 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDK2AP2 belongs to the CDK2AP family. Members of this family of proteins are cell-growth suppressors, associating with and influencing the biological activities of important cell cycle regulators in the S phase including monomeric non-phosphorylated cyclin-dependent kinase 2 (CDK2) and DNA polymerase alpha/primase. CDK2AP2 contains 5 distinct gt-ag introns. Transcription produces 7 different mRNAs, 6 alternatively spliced variants and 1 unspliced form. There are 2 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ splicing versus retention of 3 introns. CDK2AP2 plays a role in regulating self-renewal of mouse embryonic stem cells (mESC) under permissive conditions, and cell survival during differentiation of the mESC into terminally differentiated cell types.
References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • 2 Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • 3 Buajeeb W, et al. (2004) Interaction of the CDK2-associated protein-1, p12(DOC-1/CDK2AP1), with its homolog, p14(DOC-1R). Biochem Biophys Res Commun. 315(4):998-1003
  • TOP