Mouse CDK2AP2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGB454-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
384bp
Gene Synonym
Doc-1r; D19Ertd144e; 5830466O21Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CDK2-associated protein 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDK2AP2 belongs to the CDK2AP family. Members of this family of proteins are cell-growth suppressors, associating with and influencing the biological activities of important cell cycle regulators in the S phase including monomeric non-phosphorylated cyclin-dependent kinase 2 (CDK2) and DNA polymerase alpha/primase. CDK2AP2 contains 5 distinct gt-ag introns. Transcription produces 7 different mRNAs, 6 alternatively spliced variants and 1 unspliced form. There are 2 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ splicing versus retention of 3 introns. CDK2AP2 plays a role in regulating self-renewal of mouse embryonic stem cells (mESC) under permissive conditions, and cell survival during differentiation of the mESC into terminally differentiated cell types.
References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • 2 Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • 3 Buajeeb W, et al. (2004) Interaction of the CDK2-associated protein-1, p12(DOC-1/CDK2AP1), with its homolog, p14(DOC-1R). Biochem Biophys Res Commun. 315(4):998-1003
  • TOP