Mouse ASGPR1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGA595-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
855bp
Gene Synonym
Asgr, ASGPR1, Asgr-1, Asgr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse asialoglycoprotein receptor 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.
References
  • Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.
  • Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.
  • TOP