Mouse ASGPR1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009714.2

RefSeq ORF Size

855bp

Gene Synonym

Asgr, ASGPR1, Asgr-1, Asgr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse asialoglycoprotein receptor 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.

References

Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.

Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.

Catalog Number:MGA595-CY