Mouse ASGPR1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGA595-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
855bp
Gene Synonym
Asgr, ASGPR1, Asgr-1, Asgr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse asialoglycoprotein receptor 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.
References
  • Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.
  • Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.
  • TOP