Mouse ASGPR1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009714.2

RefSeq ORF Size

855bp

Gene Synonym

Asgr, ASGPR1, Asgr-1, Asgr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse asialoglycoprotein receptor 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.

References

Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.

Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.

Catalog Number:MGA595-NM