Rat Lefty2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001007556.1

RefSeq ORF Size

1101bp

Gene Synonym

Ebaf2, Lefty2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat Left-right determination factor 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

left-right determination factor 2 (Lefty2), also known as Left-right determination factor A (Lefty A), endometrial bleeding associated factor (left-right determination, factor A transforming growth factor beta superfamily), and Transforming growth factor beta-4, is a member of the TGF-beta family of proteins. This protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. Lefty2/Lefty A may also play a role in endometrial bleeding. Mutations in Lefty2/Lefty A have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. Depletion of both Lefty1 and Lefty2 causes unchecked Nodal signaling, expansion of mesendoderm, and loss of ectoderm. The expansion of mesendoderm correlates with an extended period of rapid cellular internalization and a failure of deep-cell epiboly. The gastrulation defects of embryos depleted of Lefty1 and Lefty2 result from the deregulation of Squint signaling.

References

Feldman B, et al. (2002) Lefty antagonism of Squint is essential for normal gastrulation. Curr Biol. 12(24): 2129-35.

Meno C, et al. (1999) Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 4(3): 287-98.

Meno C, et al. (2001) Diffusion of nodal signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell. 1(1): 127-38.

Catalog Number:RGE328-CO