Rat Lefty2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001007556.1

RefSeq ORF Size

1101bp

Gene Synonym

Ebaf2, Lefty2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat Left-right determination factor 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

left-right determination factor 2 (Lefty2), also known as Left-right determination factor A (Lefty A), endometrial bleeding associated factor (left-right determination, factor A transforming growth factor beta superfamily), and Transforming growth factor beta-4, is a member of the TGF-beta family of proteins. This protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. Lefty2/Lefty A may also play a role in endometrial bleeding. Mutations in Lefty2/Lefty A have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. Depletion of both Lefty1 and Lefty2 causes unchecked Nodal signaling, expansion of mesendoderm, and loss of ectoderm. The expansion of mesendoderm correlates with an extended period of rapid cellular internalization and a failure of deep-cell epiboly. The gastrulation defects of embryos depleted of Lefty1 and Lefty2 result from the deregulation of Squint signaling.

References

Feldman B, et al. (2002) Lefty antagonism of Squint is essential for normal gastrulation. Curr Biol. 12(24): 2129-35.

Meno C, et al. (1999) Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 4(3): 287-98.

Meno C, et al. (2001) Diffusion of nodal signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell. 1(1): 127-38.

Catalog Number:RGE328-CF