Rat Lefty2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:RGE328-CG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1101bp
Gene Synonym
Ebaf2, Lefty2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Left-right determination factor 2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
left-right determination factor 2 (Lefty2), also known as Left-right determination factor A (Lefty A), endometrial bleeding associated factor (left-right determination, factor A transforming growth factor beta superfamily), and Transforming growth factor beta-4, is a member of the TGF-beta family of proteins. This protein is secreted and plays a role in left-right asymmetry determination of organ systems during development. Lefty2/Lefty A may also play a role in endometrial bleeding. Mutations in Lefty2/Lefty A have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. Alternative processing of this protein can yield three different products. Depletion of both Lefty1 and Lefty2 causes unchecked Nodal signaling, expansion of mesendoderm, and loss of ectoderm. The expansion of mesendoderm correlates with an extended period of rapid cellular internalization and a failure of deep-cell epiboly. The gastrulation defects of embryos depleted of Lefty1 and Lefty2 result from the deregulation of Squint signaling.
References
  • Feldman B, et al. (2002) Lefty antagonism of Squint is essential for normal gastrulation. Curr Biol. 12(24): 2129-35.
  • Meno C, et al. (1999) Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation. Mol Cell. 4(3): 287-98.
  • Meno C, et al. (2001) Diffusion of nodal signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell. 1(1): 127-38.
  • TOP