Rat IL-9 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001105747.1

RefSeq ORF Size

435bp

Gene Synonym

IL9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 9 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin 9, also known as IL-9, is a cytokine (cell signalling molecule) belonging to the group of interleukins. IL-9 is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL-9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. IL-9 is a key molecule that affects differentiation of TH17 cells and Treg function. IL-9 predominantly produced by TH17 cells, synergizes with TGF-β1 to differentiate naïve CD4+ T cells into TH17 cells, while IL-9 secretion by TH17 cells is regulated by IL-23. Interestingly, IL-9 enhances the suppressive functions of FoxP3+ CD4+ Treg cells in vitro, and absence of IL-9 signaling weakens the suppressive activity of nTregs in vivo, leading to an increase in effector cells and worsening of experimental autoimmune encephalomyelitis. The mechanism of IL-9 effects on TH17 and Tregs is through activation of STAT3 and STAT5 signaling. Our findings highlight a role of IL-9 as a regulator of pathogenic versus protective mechanisms of immune responses.

References

Elyaman W, et al. (2009) IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci U S A. 106(31): 12885-90.

Dong Q, et al. (1999) IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol. 29(7): 2130-9.

Kimura Y, et al. (1995) Sharing of the IL-2 receptor gamma chain with the functional IL-9 receptor complex. Int Immunol. 7(1): 115-20.

Catalog Number:RGD906-NF