Rat IL-9 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGD906-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435bp
Gene Synonym
IL9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 9 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 9, also known as IL-9, is a cytokine (cell signalling molecule) belonging to the group of interleukins. IL-9 is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL-9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. IL-9 is a key molecule that affects differentiation of TH17 cells and Treg function. IL-9 predominantly produced by TH17 cells, synergizes with TGF-β1 to differentiate naïve CD4+ T cells into TH17 cells, while IL-9 secretion by TH17 cells is regulated by IL-23. Interestingly, IL-9 enhances the suppressive functions of FoxP3+ CD4+ Treg cells in vitro, and absence of IL-9 signaling weakens the suppressive activity of nTregs in vivo, leading to an increase in effector cells and worsening of experimental autoimmune encephalomyelitis. The mechanism of IL-9 effects on TH17 and Tregs is through activation of STAT3 and STAT5 signaling. Our findings highlight a role of IL-9 as a regulator of pathogenic versus protective mechanisms of immune responses.
References
  • Elyaman W, et al. (2009) IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci U S A. 106(31): 12885-90.
  • Dong Q, et al. (1999) IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol. 29(7): 2130-9.
  • Kimura Y, et al. (1995) Sharing of the IL-2 receptor gamma chain with the functional IL-9 receptor complex. Int Immunol. 7(1): 115-20.
  • TOP