Rat IL-9 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGD906-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435bp
Gene Synonym
IL9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 9 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 9, also known as IL-9, is a cytokine (cell signalling molecule) belonging to the group of interleukins. IL-9 is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL-9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. IL-9 is a key molecule that affects differentiation of TH17 cells and Treg function. IL-9 predominantly produced by TH17 cells, synergizes with TGF-β1 to differentiate naïve CD4+ T cells into TH17 cells, while IL-9 secretion by TH17 cells is regulated by IL-23. Interestingly, IL-9 enhances the suppressive functions of FoxP3+ CD4+ Treg cells in vitro, and absence of IL-9 signaling weakens the suppressive activity of nTregs in vivo, leading to an increase in effector cells and worsening of experimental autoimmune encephalomyelitis. The mechanism of IL-9 effects on TH17 and Tregs is through activation of STAT3 and STAT5 signaling. Our findings highlight a role of IL-9 as a regulator of pathogenic versus protective mechanisms of immune responses.
References
  • Elyaman W, et al. (2009) IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci U S A. 106(31): 12885-90.
  • Dong Q, et al. (1999) IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol. 29(7): 2130-9.
  • Kimura Y, et al. (1995) Sharing of the IL-2 receptor gamma chain with the functional IL-9 receptor complex. Int Immunol. 7(1): 115-20.
  • TOP