Rat GDNF Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGD072-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
Gdnf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glial cell derived neurotrophic factor Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family of ligands is comprised by four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN), and persephin (PSPN). It has been found that GFLs play a role in a number of biological processes including cell survival, neurite outgrowth, cell differentiation and cell migration. As the founding member, GDNF plays a key role in the promotion of the survival of dopaminergic neurons. GDNF is a highly conserved neurotrophic factor. The recombinant form of this protein also promotes the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. GDNF also regulates kidney development and spermatogenesis, and it affects alcohol consumption. It has been shown that GDNF results in two Parkinson's disease clinical trial and in a number of animal trials. It has been taken as a potent survival factor for central motoneurons.
References
  • Oppenheim RW, et al. (1995) Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF. Nature. 373 (6512): 344-6.
  • Tomac A, et al. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Nature. 373 (6512): 335-9.
  • Schindelhauer D, et al. (1996) The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1. Genomics. 28 (3): 605-7.
  • Carnicella S, et al. (2008) GDNF is a fast-acting potent inhibitor of alcohol consumption and relapse. Proc Natl Acad Sci . 105 (23): 8114-9.
  • TOP