Rat GDNF Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGD072-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
Gdnf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glial cell derived neurotrophic factor Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family of ligands is comprised by four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN), and persephin (PSPN). It has been found that GFLs play a role in a number of biological processes including cell survival, neurite outgrowth, cell differentiation and cell migration. As the founding member, GDNF plays a key role in the promotion of the survival of dopaminergic neurons. GDNF is a highly conserved neurotrophic factor. The recombinant form of this protein also promotes the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. GDNF also regulates kidney development and spermatogenesis, and it affects alcohol consumption. It has been shown that GDNF results in two Parkinson's disease clinical trial and in a number of animal trials. It has been taken as a potent survival factor for central motoneurons.
References
  • Oppenheim RW, et al. (1995) Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF. Nature. 373 (6512): 344-6.
  • Tomac A, et al. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Nature. 373 (6512): 335-9.
  • Schindelhauer D, et al. (1996) The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1. Genomics. 28 (3): 605-7.
  • Carnicella S, et al. (2008) GDNF is a fast-acting potent inhibitor of alcohol consumption and relapse. Proc Natl Acad Sci . 105 (23): 8114-9.
  • TOP