Rat GDNF Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGD072-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
636bp
Gene Synonym
Gdnf
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glial cell derived neurotrophic factor Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family of ligands is comprised by four neurotrophic factors: glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN), and persephin (PSPN). It has been found that GFLs play a role in a number of biological processes including cell survival, neurite outgrowth, cell differentiation and cell migration. As the founding member, GDNF plays a key role in the promotion of the survival of dopaminergic neurons. GDNF is a highly conserved neurotrophic factor. The recombinant form of this protein also promotes the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. GDNF also regulates kidney development and spermatogenesis, and it affects alcohol consumption. It has been shown that GDNF results in two Parkinson's disease clinical trial and in a number of animal trials. It has been taken as a potent survival factor for central motoneurons.
References
  • Oppenheim RW, et al. (1995) Developing motor neurons rescued from programmed and axotomy-induced cell death by GDNF. Nature. 373 (6512): 344-6.
  • Tomac A, et al. (1995) Protection and repair of the nigrostriatal dopaminergic system by GDNF in vivo. Nature. 373 (6512): 335-9.
  • Schindelhauer D, et al. (1996) The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1. Genomics. 28 (3): 605-7.
  • Carnicella S, et al. (2008) GDNF is a fast-acting potent inhibitor of alcohol consumption and relapse. Proc Natl Acad Sci . 105 (23): 8114-9.
  • TOP