Rat FSTL1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGC917-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
921bp
Gene Synonym
Frp, Fstl
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat follistatin-like 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Follistatin-related protein 1 (FSTL1)  is an extracellular glycoprotein whose functional significance in physiological and pathological processes is incompletely understood. Recently, we have shown that FSTL1 acts as a muscle-derived secreted factor that is up-regulated by Akt activation and ischemic stress and that FSTL1 exerts favorable actions on the heart and vasculature. Here, we sought to identify the receptor that mediates the cellular actions of FSTL1. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. FSTL1 is thought to be an autoantigen associated with rheumatoid arthritis. DIP2A functions as a novel receptor that mediates the cardiovascular protective effects of FSTL1. Experiment results have provided in vivo and in vitro evidence to demonstrate that Fstl1 modulates lung development and alveolar maturation, in part, through BMP4 signaling.
References
  • Rosenberg MI, et al. (2006) MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 175(1): 77-85.
  • Ouchi N, et al. (2010) DIP2A functions as a FSTL1 receptor. J Biol Chem. 285(10): 7127-34.
  • Geng Y, et al. (2011) Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 108(17): 7058-63.
  • TOP