Rat FSTL1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGC917-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
921bp
Gene Synonym
Frp, Fstl
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat follistatin-like 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Follistatin-related protein 1 (FSTL1)  is an extracellular glycoprotein whose functional significance in physiological and pathological processes is incompletely understood. Recently, we have shown that FSTL1 acts as a muscle-derived secreted factor that is up-regulated by Akt activation and ischemic stress and that FSTL1 exerts favorable actions on the heart and vasculature. Here, we sought to identify the receptor that mediates the cellular actions of FSTL1. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. FSTL1 is thought to be an autoantigen associated with rheumatoid arthritis. DIP2A functions as a novel receptor that mediates the cardiovascular protective effects of FSTL1. Experiment results have provided in vivo and in vitro evidence to demonstrate that Fstl1 modulates lung development and alveolar maturation, in part, through BMP4 signaling.
References
  • Rosenberg MI, et al. (2006) MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 175(1): 77-85.
  • Ouchi N, et al. (2010) DIP2A functions as a FSTL1 receptor. J Biol Chem. 285(10): 7127-34.
  • Geng Y, et al. (2011) Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 108(17): 7058-63.
  • TOP