Rat FSTL1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_024369.2

RefSeq ORF Size

921bp

Gene Synonym

Frp, Fstl

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat follistatin-like 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Follistatin-related protein 1 (FSTL1) is an extracellular glycoprotein whose functional significance in physiological and pathological processes is incompletely understood. Recently, we have shown that FSTL1 acts as a muscle-derived secreted factor that is up-regulated by Akt activation and ischemic stress and that FSTL1 exerts favorable actions on the heart and vasculature. Here, we sought to identify the receptor that mediates the cellular actions of FSTL1. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. FSTL1 is thought to be an autoantigen associated with rheumatoid arthritis. DIP2A functions as a novel receptor that mediates the cardiovascular protective effects of FSTL1. Experiment results have provided in vivo and in vitro evidence to demonstrate that Fstl1 modulates lung development and alveolar maturation, in part, through BMP4 signaling.

References

Rosenberg MI, et al. (2006) MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 175(1): 77-85.

Ouchi N, et al. (2010) DIP2A functions as a FSTL1 receptor. J Biol Chem. 285(10): 7127-34.

Geng Y, et al. (2011) Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 108(17): 7058-63.

Catalog Number:RGC917-CO