Rat OX-40L / TNFSF4 / CD252 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGF549-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
600bp
Gene Synonym
Ox40l, Txgp1, Tnfsf4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 4 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.
References
  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • TOP