Rat OX-40L / TNFSF4 / CD252 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGF549-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
600bp
Gene Synonym
Ox40l, Txgp1, Tnfsf4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.
References
  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • TOP