Mouse NAALADL1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001009546.1

RefSeq ORF Size

2238bp

Gene Synonym

Gm964, Naaladasel, Naaladl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse N-acetylated alpha-linked acidic dipeptidase-like 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

N-acetylated-alpha-linked acidic dipeptidase-like protein, also known as NAALADL1, NAALADase L, and Ileal dipeptidylpeptidase, is a Single-pass type I I membrane protein and a member of the peptidase M28 family and M28B subfamily. NAALADase L is mainly expressed in the distal small intestine. It is also expressed in the spleen and testis and Weakly expressed in the brain, locating mainly to the brain stem, amygdala, thalamus and ventral striatum. NAALADase L is a chloride-activated, membrane bound, metallopeptidase that cleaves the endogenous neuropeptide N-acetyl-aspartyl-glutamate (NAAG). NAAG acts as a partial NMDA agonist as well as a full agonist at the presynaptic metabotropic glutamate receptor 3 (mGluR3), where it acts to reduce glutamate release. NAALADase L also exhibits a dipeptidyl-peptidase IV type activity. NAALADase inhibition may be a novel therapeutic approach to reduce or inhibit heightened aggressiveness, and possibly to treat aggressive behavior associated with psychiatric disorders.

References

Stauch BL. 1989, Neurosci Lett. 100 (1-3): 295-300.

Shneider BL. et al., 1997, J. Biol. Chem. 272: 31006-15.

Pangalos MN. et al., 1999, J. Biol. Chem. 274: 8470-83.

Thomas AG. et al., 1999, Brain Res. 843 (1-2): 48-52.

Catalog Number:MGF119-NO