Mouse NAALADL1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001009546.1

RefSeq ORF Size

2238bp

Gene Synonym

Gm964, Naaladasel, Naaladl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse N-acetylated alpha-linked acidic dipeptidase-like 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

N-acetylated-alpha-linked acidic dipeptidase-like protein, also known as NAALADL1, NAALADase L, and Ileal dipeptidylpeptidase, is a Single-pass type I I membrane protein and a member of the peptidase M28 family and M28B subfamily. NAALADase L is mainly expressed in the distal small intestine. It is also expressed in the spleen and testis and Weakly expressed in the brain, locating mainly to the brain stem, amygdala, thalamus and ventral striatum. NAALADase L is a chloride-activated, membrane bound, metallopeptidase that cleaves the endogenous neuropeptide N-acetyl-aspartyl-glutamate (NAAG). NAAG acts as a partial NMDA agonist as well as a full agonist at the presynaptic metabotropic glutamate receptor 3 (mGluR3), where it acts to reduce glutamate release. NAALADase L also exhibits a dipeptidyl-peptidase IV type activity. NAALADase inhibition may be a novel therapeutic approach to reduce or inhibit heightened aggressiveness, and possibly to treat aggressive behavior associated with psychiatric disorders.

References

Stauch BL. 1989, Neurosci Lett. 100 (1-3): 295-300.

Shneider BL. et al., 1997, J. Biol. Chem. 272: 31006-15.

Pangalos MN. et al., 1999, J. Biol. Chem. 274: 8470-83.

Thomas AG. et al., 1999, Brain Res. 843 (1-2): 48-52.

Catalog Number:MGF119-CY