Mouse NAALADL1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF119-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2238bp
Gene Synonym
Gm964, Naaladasel, Naaladl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse N-acetylated alpha-linked acidic dipeptidase-like 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
N-acetylated-alpha-linked acidic dipeptidase-like protein, also known as NAALADL1, NAALADase L, and Ileal dipeptidylpeptidase, is a Single-pass type I I membrane protein and a member of the peptidase M28 family and M28B subfamily. NAALADase L is mainly expressed in the distal small intestine. It is also expressed in the spleen and testis and Weakly expressed in the brain, locating mainly to the brain stem, amygdala, thalamus and ventral striatum. NAALADase L is a chloride-activated, membrane bound, metallopeptidase that cleaves the endogenous neuropeptide N-acetyl-aspartyl-glutamate (NAAG). NAAG acts as a partial NMDA agonist as well as a full agonist at the presynaptic metabotropic glutamate receptor 3 (mGluR3), where it acts to reduce glutamate release. NAALADase L also exhibits a dipeptidyl-peptidase IV type activity. NAALADase inhibition may be a novel therapeutic approach to reduce or inhibit heightened aggressiveness, and possibly to treat aggressive behavior associated with psychiatric disorders.
References
  • Stauch BL. 1989, Neurosci Lett. 100 (1-3): 295-300.
  • Shneider BL. et al., 1997, J. Biol. Chem. 272: 31006-15.
  • Pangalos MN. et al., 1999, J. Biol. Chem. 274: 8470-83.
  • Thomas AG. et al., 1999, Brain Res. 843 (1-2): 48-52.
  • TOP