Mouse MKK4/MEK4/MAP2K4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGE865-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194bp
Gene Synonym
MEK4, MKK4, Sek1, JNKK1, Serk1, PRKMK4, Map2k4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dual specificity mitogen-activated protein kinase kinase 4, also known as MAP kinase kinase 4, MAPKK4, JNK-activating kinase 1, MAPK/ERK kinase 4, SAPK/ERK kinase 1, c-Jun N-terminal kinase kinase 1, JNKK and MAP2K4, is a protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K4 / JNKK1 is a protein kinase which is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. MAP2K4 / JNKK1 has been shown to activate MAPK8 / JNK1, MAPK9 / JNK2, and MAPK14 / p38, but not MAPK1 / ERK2 or MAPK3 / ERK1. MAP2K4 / JNKK1 is phosphorylated, and thus activated by MAP3K1 / MEKK. The stress-activated protein kinase (SAPK) pathways represent phosphorylation cascades that convey pro-apoptotic signals. The mitogen-activated protein kinase kinase (MAPKK) homolog MAP2K4 ( MKK4, SEK, JNKK1 ) is a centrally-placed mediator of the SAPK pathways.
References
  • Lin A, et al.,1995, Science 268 (5208): 286-90.
  • Su,G.H. et al., 2002, Hum Mutat. 19 (1):81.
  • Lee, et al., 2002, Proc. Natl. Acad. Sci. USA. 99 (22): 14189-94.
  • Bouzakri,K. et al., 2007, J Biol Chem. 282 (11):7783-9.
  • TOP