Mouse MKK4/MEK4/MAP2K4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGE865-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194bp
Gene Synonym
MEK4, MKK4, Sek1, JNKK1, Serk1, PRKMK4, Map2k4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dual specificity mitogen-activated protein kinase kinase 4, also known as MAP kinase kinase 4, MAPKK4, JNK-activating kinase 1, MAPK/ERK kinase 4, SAPK/ERK kinase 1, c-Jun N-terminal kinase kinase 1, JNKK and MAP2K4, is a protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K4 / JNKK1 is a protein kinase which is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. MAP2K4 / JNKK1 has been shown to activate MAPK8 / JNK1, MAPK9 / JNK2, and MAPK14 / p38, but not MAPK1 / ERK2 or MAPK3 / ERK1. MAP2K4 / JNKK1 is phosphorylated, and thus activated by MAP3K1 / MEKK. The stress-activated protein kinase (SAPK) pathways represent phosphorylation cascades that convey pro-apoptotic signals. The mitogen-activated protein kinase kinase (MAPKK) homolog MAP2K4 ( MKK4, SEK, JNKK1 ) is a centrally-placed mediator of the SAPK pathways.
References
  • Lin A, et al.,1995, Science 268 (5208): 286-90.
  • Su,G.H. et al., 2002, Hum Mutat. 19 (1):81.
  • Lee, et al., 2002, Proc. Natl. Acad. Sci. USA. 99 (22): 14189-94.
  • Bouzakri,K. et al., 2007, J Biol Chem. 282 (11):7783-9.
  • TOP