Mouse MKK4/MEK4/MAP2K4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGE865-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194bp
Gene Synonym
MEK4, MKK4, Sek1, JNKK1, Serk1, PRKMK4, Map2k4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dual specificity mitogen-activated protein kinase kinase 4, also known as MAP kinase kinase 4, MAPKK4, JNK-activating kinase 1, MAPK/ERK kinase 4, SAPK/ERK kinase 1, c-Jun N-terminal kinase kinase 1, JNKK and MAP2K4, is a protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K4 / JNKK1 is a protein kinase which is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. MAP2K4 / JNKK1 has been shown to activate MAPK8 / JNK1, MAPK9 / JNK2, and MAPK14 / p38, but not MAPK1 / ERK2 or MAPK3 / ERK1. MAP2K4 / JNKK1 is phosphorylated, and thus activated by MAP3K1 / MEKK. The stress-activated protein kinase (SAPK) pathways represent phosphorylation cascades that convey pro-apoptotic signals. The mitogen-activated protein kinase kinase (MAPKK) homolog MAP2K4 ( MKK4, SEK, JNKK1 ) is a centrally-placed mediator of the SAPK pathways.
References
  • Lin A, et al.,1995, Science 268 (5208): 286-90.
  • Su,G.H. et al., 2002, Hum Mutat. 19 (1):81.
  • Lee, et al., 2002, Proc. Natl. Acad. Sci. USA. 99 (22): 14189-94.
  • Bouzakri,K. et al., 2007, J Biol Chem. 282 (11):7783-9.
  • TOP