Mouse MAG/GMA/Siglec-4 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010758.2

RefSeq ORF Size

1749bp

Gene Synonym

Gma, siglec-4a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse myelin-associated glycoprotein Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 100kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.

References

Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.

Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.

Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.

Catalog Number:MGE638-NY