Mouse MAG/GMA/Siglec-4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010758.2

RefSeq ORF Size

1749bp

Gene Synonym

Gma, siglec-4a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse myelin-associated glycoprotein Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 100kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.

References

Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.

Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.

Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.

Catalog Number:MGE638-NM