Mouse MAG/GMA/Siglec-4 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:MGE638-CG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749bp
Gene Synonym
Gma, siglec-4a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse myelin-associated glycoprotein Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 100kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.
References
  • Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.
  • Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.
  • Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.
  • TOP