Mouse GLIPR1 / RTVP1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD123-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
768bp
Gene Synonym
RTVP1, RTVP-1, mRTVP-1, 2410114O14Rik, Glipr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse GLI pathogenesis-related 1 (glioma) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glioma pathogenesis-related protein 1, also known as Protein RTVP-1, GLIPR1 and GLIPR, is a single-pass membrane protein which belongs to the CRISP family. GLIPR1 / RTVP-1 was expressed in high levels in glioblastomas, whereas its expression in low-grade astrocytomas and normal brains was very low. Transfection of glioma cells with small interfering RNAs targeting GLIPR1 / RTVP-1 decreased cell proliferation in all the cell lines examined and induced cell apoptosis in some of them. Overexpression of GLIPR1 / RTVP-1 increased astrocyte and glioma cell proliferation and the anchorage-independent growth of the cells. In addition, overexpression of GLIPR1 / RTVP-1 rendered glioma cells more resistant to the apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand and serum deprivation. GLIPR1 / RTVP-1 regulated the invasion of glioma cells was evident by their enhanced migration through Matrigel and by their increased invasion in a spheroid confrontation assay. The increased invasive potential of the GLIPR1 / RTVP-1 overexpressors was also shown by the increased activity of matrix metalloproteinase 2 in these cells. The expression of GLIPR1 / RTVP-1 is correlated with the degree of malignancy of astrocytic tumors and that GLIPR1 / RTVP-1 is involved in the regulation of the growth, survival, and invasion of glioma cells. GLIPR1 / RTVP-1 is a potential therapeutic target in gliomas.
References
  • Murphy E.V., et al., 1995, Gene. 159:131-5.
  • Rich T., et al., 1996, Gene. 180:125-30.
  • Rosenzweig,T. et al., 2006, Cancer Res. 66 (8):4139-48.
  • TOP