Mouse GLIPR1 / RTVP1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD123-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
768bp
Gene Synonym
RTVP1, RTVP-1, mRTVP-1, 2410114O14Rik, Glipr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse GLI pathogenesis-related 1 (glioma) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glioma pathogenesis-related protein 1, also known as Protein RTVP-1, GLIPR1 and GLIPR, is a single-pass membrane protein which belongs to the CRISP family. GLIPR1 / RTVP-1 was expressed in high levels in glioblastomas, whereas its expression in low-grade astrocytomas and normal brains was very low. Transfection of glioma cells with small interfering RNAs targeting GLIPR1 / RTVP-1 decreased cell proliferation in all the cell lines examined and induced cell apoptosis in some of them. Overexpression of GLIPR1 / RTVP-1 increased astrocyte and glioma cell proliferation and the anchorage-independent growth of the cells. In addition, overexpression of GLIPR1 / RTVP-1 rendered glioma cells more resistant to the apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand and serum deprivation. GLIPR1 / RTVP-1 regulated the invasion of glioma cells was evident by their enhanced migration through Matrigel and by their increased invasion in a spheroid confrontation assay. The increased invasive potential of the GLIPR1 / RTVP-1 overexpressors was also shown by the increased activity of matrix metalloproteinase 2 in these cells. The expression of GLIPR1 / RTVP-1 is correlated with the degree of malignancy of astrocytic tumors and that GLIPR1 / RTVP-1 is involved in the regulation of the growth, survival, and invasion of glioma cells. GLIPR1 / RTVP-1 is a potential therapeutic target in gliomas.
References
  • Murphy E.V., et al., 1995, Gene. 159:131-5.
  • Rich T., et al., 1996, Gene. 180:125-30.
  • Rosenzweig,T. et al., 2006, Cancer Res. 66 (8):4139-48.
  • TOP