Mouse GLIPR1 / RTVP1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_028608.3

RefSeq ORF Size

768bp

Gene Synonym

RTVP1, RTVP-1, mRTVP-1, 2410114O14Rik, Glipr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse GLI pathogenesis-related 1 (glioma) Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Glioma pathogenesis-related protein 1, also known as Protein RTVP-1, GLIPR1 and GLIPR, is a single-pass membrane protein which belongs to the CRISP family. GLIPR1 / RTVP-1 was expressed in high levels in glioblastomas, whereas its expression in low-grade astrocytomas and normal brains was very low. Transfection of glioma cells with small interfering RNAs targeting GLIPR1 / RTVP-1 decreased cell proliferation in all the cell lines examined and induced cell apoptosis in some of them. Overexpression of GLIPR1 / RTVP-1 increased astrocyte and glioma cell proliferation and the anchorage-independent growth of the cells. In addition, overexpression of GLIPR1 / RTVP-1 rendered glioma cells more resistant to the apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand and serum deprivation. GLIPR1 / RTVP-1 regulated the invasion of glioma cells was evident by their enhanced migration through Matrigel and by their increased invasion in a spheroid confrontation assay. The increased invasive potential of the GLIPR1 / RTVP-1 overexpressors was also shown by the increased activity of matrix metalloproteinase 2 in these cells. The expression of GLIPR1 / RTVP-1 is correlated with the degree of malignancy of astrocytic tumors and that GLIPR1 / RTVP-1 is involved in the regulation of the growth, survival, and invasion of glioma cells. GLIPR1 / RTVP-1 is a potential therapeutic target in gliomas.

References

Murphy E.V., et al., 1995, Gene. 159:131-5.

Rich T., et al., 1996, Gene. 180:125-30.

Rosenzweig,T. et al., 2006, Cancer Res. 66 (8):4139-48.

Catalog Number:MGD123-NO