Mouse Epiregulin/EREG Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007950.2

RefSeq ORF Size

489bp

Gene Synonym

EPR, MGC36144, Ereg

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse epiregulin Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Epiregulin (EREG) is a member of the epidermal growth factor family. Epiregulin (EREG) can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. Epiregulin (EREG) exhibit bifunctional regulatory properties: it inhibit the growth of several epithelial tumor cells and stimulated the growth of fibroblasts and various other types of cells. Epiregulin (EREG) bound to the EGF receptors of epidermoid carcinoma A431 cells much more weakly than did EGF, but was nevertheless much more potent than EGF as a mitogen for rat primary hepatocytes and Balb/c 3T3 A31 fibroblasts. These findings suggest that epiregulin (EREG) plays important roles in regulating the growth of epithelial cells and fibroblasts by binding to receptors for EGF-related ligands. Epiregulin (EREG) is the broadest specificity EGF-like ligand so far characterized: not only does it stimulate homodimers of both ErbB-1 and ErbB-4, it also activates all possible heterodimeric ErbB complexes.

References

Shelly M, et al. (1998) Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem. 1998 Apr 24;273(17):10496-505.

Shirakata Y, et al. (2000) Epiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem. 275(8): 5748-53.

Zhu Z, et al. (2000) Epiregulin is Up-regulated in pancreatic cancer and stimulates pancreatic cancer cell growth. Biochem Biophys Res Commun. 273(3): 1019-24.

Catalog Number:MGC557-NY