Mouse Epiregulin/EREG Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGC557-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
489bp
Gene Synonym
EPR, MGC36144, Ereg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse epiregulin Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Epiregulin (EREG) is a member of the epidermal growth factor family. Epiregulin (EREG) can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. Epiregulin (EREG) exhibit bifunctional regulatory properties: it inhibit the growth of several epithelial tumor cells and stimulated the growth of fibroblasts and various other types of cells. Epiregulin (EREG) bound to the EGF receptors of epidermoid carcinoma A431 cells much more weakly than did EGF, but was nevertheless much more potent than EGF as a mitogen for rat primary hepatocytes and Balb/c 3T3 A31 fibroblasts. These findings suggest that epiregulin (EREG) plays important roles in regulating the growth of epithelial cells and fibroblasts by binding to receptors for EGF-related ligands. Epiregulin (EREG) is the broadest specificity EGF-like ligand so far characterized: not only does it stimulate homodimers of both ErbB-1 and ErbB-4, it also activates all possible heterodimeric ErbB complexes.
References
  • Shelly M, et al. (1998) Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem. 1998 Apr 24;273(17):10496-505.
  • Shirakata Y, et al. (2000) Epiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem. 275(8): 5748-53.
  • Zhu Z, et al. (2000) Epiregulin is Up-regulated in pancreatic cancer and stimulates pancreatic cancer cell growth. Biochem Biophys Res Commun. 273(3): 1019-24.
  • TOP