Mouse Epiregulin/EREG Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007950.2

RefSeq ORF Size

489bp

Gene Synonym

EPR, MGC36144, Ereg

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse epiregulin Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Epiregulin (EREG) is a member of the epidermal growth factor family. Epiregulin (EREG) can function as a ligand of EGFR (epidermal growth factor receptor), as well as a ligand of most members of the ERBB (v-erb-b2 oncogene homolog) family of tyrosine-kinase receptors. Epiregulin (EREG) exhibit bifunctional regulatory properties: it inhibit the growth of several epithelial tumor cells and stimulated the growth of fibroblasts and various other types of cells. Epiregulin (EREG) bound to the EGF receptors of epidermoid carcinoma A431 cells much more weakly than did EGF, but was nevertheless much more potent than EGF as a mitogen for rat primary hepatocytes and Balb/c 3T3 A31 fibroblasts. These findings suggest that epiregulin (EREG) plays important roles in regulating the growth of epithelial cells and fibroblasts by binding to receptors for EGF-related ligands. Epiregulin (EREG) is the broadest specificity EGF-like ligand so far characterized: not only does it stimulate homodimers of both ErbB-1 and ErbB-4, it also activates all possible heterodimeric ErbB complexes.

References

Shelly M, et al. (1998) Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J Biol Chem. 1998 Apr 24;273(17):10496-505.

Shirakata Y, et al. (2000) Epiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem. 275(8): 5748-53.

Zhu Z, et al. (2000) Epiregulin is Up-regulated in pancreatic cancer and stimulates pancreatic cancer cell growth. Biochem Biophys Res Commun. 273(3): 1019-24.

Catalog Number:MGC557-NF