Mouse EBP1/PA2G4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC363-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1185bp
Gene Synonym
Ebp1; 38kDa; Plfap; AA672939
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse proliferation-associated 2G4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EBP1, also known as PA2G4, is an RNA-binding protein which belongs to the peptidase M24 family. It can be detected n several cell lines tested, including primary and transformed cell lines. EBP1 also present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein is a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. PA2G4 can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. EBP1 has been implicated in growth inhibition and the induction of differentiation of human cancer cells. It seems to be involved in growth regulation. EBP1 also mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site).
References
  • Yoo J Y, et al. (2000) Interaction of the PA2G4 (EBP1) protein with ErbB-3 and regulation of this binding by heregulin. Br J Cancer. 82(3):683-90.
  • Andersen JS, et al. (2002) Directed proteomic analysis of the human nucleolus. Curr Biol. 12(1):1-11.
  • Lehner B, et al. (2004) A protein interaction framework for human mRNA degradation. Genome Res. 14 (7):1315-23.
  • TOP