Mouse EBP1/PA2G4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGC363-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1185bp
Gene Synonym
Ebp1; 38kDa; Plfap; AA672939
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse proliferation-associated 2G4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EBP1, also known as PA2G4, is an RNA-binding protein which belongs to the peptidase M24 family. It can be detected n several cell lines tested, including primary and transformed cell lines. EBP1 also present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein is a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. PA2G4 can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. EBP1 has been implicated in growth inhibition and the induction of differentiation of human cancer cells. It seems to be involved in growth regulation. EBP1 also mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site).
References
  • Yoo J Y, et al. (2000) Interaction of the PA2G4 (EBP1) protein with ErbB-3 and regulation of this binding by heregulin. Br J Cancer. 82(3):683-90.
  • Andersen JS, et al. (2002) Directed proteomic analysis of the human nucleolus. Curr Biol. 12(1):1-11.
  • Lehner B, et al. (2004) A protein interaction framework for human mRNA degradation. Genome Res. 14 (7):1315-23.
  • TOP