Mouse EBP1/PA2G4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011119.3

RefSeq ORF Size

1185bp

Gene Synonym

Ebp1; 38kDa; Plfap; AA672939

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse proliferation-associated 2G4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

EBP1, also known as PA2G4, is an RNA-binding protein which belongs to the peptidase M24 family. It can be detected n several cell lines tested, including primary and transformed cell lines. EBP1 also present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein is a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. PA2G4 can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. EBP1 has been implicated in growth inhibition and the induction of differentiation of human cancer cells. It seems to be involved in growth regulation. EBP1 also mediates cap-independent translation of specific viral IRESs (internal ribosomal entry site).

References

Yoo J Y, et al. (2000) Interaction of the PA2G4 (EBP1) protein with ErbB-3 and regulation of this binding by heregulin. Br J Cancer. 82(3):683-90.

Andersen JS, et al. (2002) Directed proteomic analysis of the human nucleolus. Curr Biol. 12(1):1-11.

Lehner B, et al. (2004) A protein interaction framework for human mRNA degradation. Genome Res. 14 (7):1315-23.

Catalog Number:MGC363-CO