Mouse CD99L2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001199349.1

RefSeq ORF Size

714bp

Gene Synonym

Xap89, Mic2l1, AW548191, Cd99l2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CD99 antigen-like 2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

References

Suh, YH. et al., 2003, Gene. 307: 63-76.

Park,S.H. Gene 2005, 353 (2):177-88.

Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.

Bixel, MG. et al., 2010, Blood. 116 (7):1172-84.

Catalog Number:MGB411-NY